One of the most commonly asked questions about evolution is, "Can mutations produce new genetic information?"
The answer is yes. The human genome consists of about 3 billion "letters" called nucleotides. When sexual reproduction occurs, half of these letters are copied from each parent and used to create the child. This copying process is not perfect, and sometimes the DNA "letters" are changed. This change is called a mutation.
There is something called an "insertion mutation" which adds one or more "letters" to the gene. A certain bacteria was subject to an insertion mutation, and this led to its ability to digest nylon. In another case, E. Coli was observed to undergo 2 insertion mutations which allowed it to digest Salicin. Furthermore, insertion sequences have had major contributions in the evolution of primates.
There is yet another way that mutations can increase the information in the genome: Genetic Duplication. Most of our DNA does not actually code for proteins. This is referred to as "non-coding DNA". This noncoding DNA is easily produced by gene duplication (another type of copying error). When this happens, an extra copy of a gene (or even a piece of a gene) is made that is not used. Since it is not used, it can undergo all sorts of mutations without affecting the organism. Here is an example: Imagine the following is an unused copy of a gene:
AATGCCCAATGGAACTGATGA
It can undergo insertion mutation (The letters in red are the insertion):
AATTCCGCCCAATGGAACTGATGA
It can undergo a substitution mutation, in which one or more letters are substituted with another (the letters in red were substituted with another):
ATTTCCGCCCAATGGAACTGATGA
It can undergo inversion mutation, in which the sequence of letters is turned backwards (the letters in red were inverted):
ATTTCCGCCCAATGGAGTAGTCAA
All of these mutations can happen again and again until the gene is unrecognizable. Thus, these noncoding duplications provide the organism with a grab bag of raw genetic material.
The last step in this process is when this "noncoding DNA" becomes coding and is actually used to make proteins. An interesting example of this is the "antifreeze" proteins in cod fish that allow them to survive frigid waters.
There are lots of examples of less radically modified gene duplicates leading to new and important functions. For example, the evolution of the hemoglobin genes, the evolution of light-sensitive cells via gene duplication, and many others. A protein which confers HIV resistance in monkeys was created by a piece of one gene being "tacked on" to another.
Yet another way to produce new genes is when messenger RNA is accidentally converted to DNA (usually it is the other way around). A Sperm specific gene in a species of fruit fly originated in this way.In conclusion, I would like to pose a challenge to creationists: Can you name just one gene, from any organism, that could not be produced by evolutionary processes?
